In the Russian North Caucasus the Kabardinian and Ossetian populations are also notable for high rates of G-M201. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. The origin of haplogroup G is controversial. Although the phylogenetic resolution within hg G has progressed,1, 17 a comprehensive survey of the geographic distribution patterns of significant hg G sub-clades has not been conducted. Haak W, Balanovsky O, Sanchez JJ et al. This is likely due to a local founder effect.[40]. Drawing the history of the Hutterite population on a genetic landscape: inference from Y-chromosome and mtDNA genotypes. The geographic origins of a Y chromosome haplogroup for males can be deciphered from the phylogenetic tree of mankind, or the Y-DNA Haplogroup Tree, maintained by the International Society of Genetic Genealogy ( ISOGG, 2016 ). Haplogroup G2a (G-P15) has been identified in Neolithic human remains in Europe dating between 5000 and 3000 BC. In contrast, the only U1 representative in Europe is the G-M527 lineage whose distribution pattern is consistent with regions of Greek colonization. The second common hg G lineage in the Caucasus is U1, which has its highest frequencies in the South (22.8% in Abkhazians) and NW Caucasus (about 39.7% in Adyghe and 36.5% in Cherkessians), but also reaches the Near/Middle East with the highest frequency in Palestinians (16.7%) and, shows extremely low frequency in Eastern Europe. Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood. Dulik MC, Zhadanov SI, Osipova LP et al. The formula for the coalescence calculations is as follows: Age=25/1000 ASD0/0.00069. It is a branch of haplogroup G (Y-DNA) (M201). Am J Hum Genet 2004; 74: 10231034. Mol Biol Evol 2011; 28: 29052920. It was then learned that several subclades belong under L223, including: G-L91 was identified in 2009. Ancient DNA suggests the leading role played by men in the Neolithic dissemination. G-M406* (G2a2b1*; previously G2a3a*) and its subclades seem most commonly found in Turkey and the coastal areas of the eastern Mediterranean where it can constitute up to 5% of all makes and 50% of haplogroup G samples. PLoS Biol 2010; 8: e1000536. While acknowledging that the inference of the age and geographic source of dispersals of Y chromosome haplogroups from the frequency and STR diversity data can be approximate at best, we speculate that this lineage could potentially be associated with the Linearbandkeramik (LBK) culture of Central Europe, as its highest frequency (3.45.1%) and Td estimate (Supplementary Table S4) of 108703029 years ago occur there. Zhivotovsky LA, Underhill PA, Feldman MW : Difference between evolutionarily effective and germ line mutation rate due to stochastically varying haplogroup size. A clade of closely related Ashkenazi Jews represent virtually all G2b persons, with just three other G2b haplotypes having been reported so far: one Turk from Kars in northeast Turkey near Armenia, one Pashtun, and one Burusho in Pakistan. Chiaroni J, King RJ, Myres NM et al. Mol Phylogenet Evol 2007; 44: 228239. Haplogroup P (P295) is also klnown as K2b2. [26][27] Among the Druze mostly residents of Israel 10% were found to be haplogroup G.[28], Around 10% of Jewish males are Haplogroup G.[citation needed], In Africa, haplogroup G is rarely found in sub-Saharan Africa or south of the horn of Africa among native populations. ASD0 is the average squared difference in the number of repeats between all current chromosomes of a sample and the founder haplotype, which is estimated as the median of current haplotypes. The genetic heritage of the earliest settlers persists both in Indian tribal and caste populations. Am J Hum Genet 2008; 82: 873882. Haplogroup G1 is a primary subclade of haplogroup G . In the Tirol (Tyrol) of western Austria, the percentage of G-M201 can reach 40% or more; perhaps the most famous example is the ancient remains of the so-called "Iceman", tzi. Hg G is very frequent in NW Caucasus and South Caucasus, covering about 45% of the paternal lineages in both regions2 in this study. MH and MHS are thankful to the National Institute for Genetic Engineering and Biotechnology, Tehran, Iran, and the National Research Institute for Science policy, Tehran, Iran, for providing the samples. Men who belong to this group but are negative for all G2 subclades represent a small number of haplogroup G men. Am J Hum Genet 2007; 80: 759768. G2a2b2a is also found in India. In other words, these mutations are so unique that they could only come from other cells with the same mutations. Although hg G1 frequency distribution, overall, extends further eastward as far as Central Asian Kazakhs (present even among Altaian Kazakhs38 with identical STR haplotypes compared with the main Kazakh population), it is virtually absent in Europe. G-M377, now also known as G2b1, has previously been designated G2b and G2c. G is found mostly in the north central Middle East and the Caucasus, with smaller numbers around the Mediterranean and eastward. The identification of a new SNP can necessitate renaming of one or more categories. Haplogroup G men who belong to this group, but are negative for all G2a subclades, are uncommon in Europe but may represent a sizeable group in so far poorly tested areas east of Turkey. Spallanzani, Universit di Pavia, Pavia, Italy, Viola Grugni,Vincenza Battaglia,Carmela Nici,Francesca Crobu,Sena Karachanak,Baharak Hooshiar Kashani&Ornella Semino, Department of Medical Genetics, Medical University of Sofia, Sofia, Bulgaria, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, Iran, Istituto di Genetica Molecolare Centro Nazionale delle Ricerche, Pavia, Italy, Centro Interdipartimentale Studi di Genere, Universit di Pavia, Pavia, Italy, Unit Mixte de Recherche 6578, Centre National de la Recherche Scientifique, and Etablissement Franais du Sang, Biocultural Anthropology, Medical Faculty, Universit de la Mditerrane, Marseille, France, Estonian Academy of Sciences, Tallinn, Estonia, Department of Biological Anthropology, University of Cambridge, Cambridge, UK, Department of Genetics, Stanford University School of Medicine, Stanford, CA, USA, You can also search for this author in The emergence of Y-chromosome haplogroup J1e among Arabic-speaking populations. The final major subclade is characterized by presence of the SNP Z1903 and by a value of 9 at marker DYS568. Eur J Hum Genet 2004; 12: 855863. (Previously the name Haplogroup M was assigned to K2b1d. The coalescent times (Td) of various haplogroups were estimated using the ASDo methodology described by Zhivotovsky et al,32 modified according to Sengupta et al.13 We used the evolutionary effective mutation rate of 6.9 104 per 25 years, as pedigree rates are arguably only pertinent to shallow rooted familial pedigrees,33 as they do not consider the evolutionary consequences of population dynamics including the rapid extinction of newly appearing microsatellite alleles. Almost all L141 men belong to L141 subclades. The Y-chromosomal haplogroup G (hg G) is currently defined as one of the 20 standard haplogroups comprising the global Y-chromosome phylogeny.1 The phylogeographic demarcation zone of hg G is largely restricted to populations of the Caucasus and the Near/Middle East and southern Europe. Haplogroup G ( M201) is a human Y-chromosome haplogroup. The presence of M527 in Provence, southern Italy and Ukraine may reflect subsequent Greek maritime Iron Age colonization events16 and perhaps, given its appearance among the Druze and Palestinians, even episodes associated with the enigmatic marauding Sea Peoples.42. G1 is possibly believed to have originated in Iran. G2a3a-M406 has a modest presence in Thessaly and the Peloponnese (4%),10 areas of the initial Greek Neolithic settlements. The number of STR marker values separating men in this group suggest G-PF3359 is a relatively old group despite the small number of men involved. Lacan M, Keyser C, Ricaut FX et al. Reduced genetic structure of the Iberian peninsula revealed by Y-chromosome analysis: implications for population demography. Included within G-L91 are some men with double values for STR marker DYS19, but there are also G2a2 men with this finding who are not L91+. King RJ, Ozcan SS, Carter T et al. Using Y-STR data, the Td expansion time for all combined P15-affiliated chromosomes was estimated to be 150822217 years ago. A subset of 693 samples was typed for short tandem repeats of Y-chromosome (Y-STRs) using the 17 STR markers in the Applied Biosystems AmpFlSTR Yfiler Kit according to manufacturer recommendations. Spatial autocorrelation analysis was carried out to assess the presence/absence of clines regarding informative G sub-haplogroups. Differential Y-chromosome Anatolian influences on the Greek and Cretan Neolithic. The most recent study (2010) estimates the common ancestor of all men in haplogroup G lived in Asia about 17,000 years ago, and the ancestor of the G2 subgroup lived about 15,000 years ago. In the Greek island of Crete, approximately 7%[18] to 11%[19] of males belong to haplogroup G. Basically, haplogroups refer to organisms that have a common ancestor, identified by studying the nucleotide and mitochondrial mutations in cells. Hum Genet 2009; 126: 707717. Origin. While it is found in percentages higher than 10% among the Bakhtiari, Talysh people, Gilaki, Mazandarani and Iranian Azeris, it is closer to 5% among the Iranian Arabs and in some large cities. In Lebanon, however, G accounts for 6.5% of the population and in Iran to around 10%. G-P303*, also known as G2a2b2a* (previously G2a3b1*), and its subclades are now concentrated in southern Russia and the Caucasus, as well as, at lower levels, other parts of Europe and South West Asia, especially an area including Turkey, Iran and the Middle East where G2a2b2a may have originated. The highest frequency values for P303 are detected in populations from Caucasus region, being especially high among South Caucasian Abkhazians (24%) and among Northwest (NW) Caucasian Adyghe and Cherkessians39.7% and 36.5%, respectively. Haplogroup F is the parent of haplogroups from G to R; however excluding these common haplogroups, the minor clades F*, F1, and F2, seem to appear in the Indian continent [68]. Semino O, Santachiara-Benerecetti AS, Falaschi F, Cavalli-Sforza LL, Underhill PA : Ethiopians and Khoisan share the deepest clades of the human Y-chromosome phylogeny. In 2012, SNPs with the Z designation as first identified by citizen researchers from 1000 Genomes Project data began to appear. G2a was found also in 20 out of 22 samples of ancient Y-DNA from Treilles, the type-site of a Late Neolithic group of farmers in the South of France, dated to about 5000 years ago. Similarly, G-P16 and G-M377 networks were created using 104 P16-derived 19-locus haplotypes and 61G-M377-derived 9-locus haplotypes, with both groups representing European, Near/Middle Eastern and central/west Asian populations. Croat Med J 2005; 46: 502513. BMC Evol Biol 2011; 11: 69. (2004) Origin, diffusion, and differentiation of Y-chromosome haplogroups E and J: inferences on the neolithization of Europe and later migratory events in the . Thus, G2a3a-M406, along with other lineages, such as J2a3b1-M92 and J2a4h2-DYS445=616, may track the expansion of the Neolithic from Central/Mediterranean Anatolia to Greece/Italy and Iran. [21] In a study of 936 Indians, haplogroup G made up less than 1% of the sample and was completely absent in the tested Northwestern Indian population. In descending order, G-P303 is additionally a branch of G2 (P287), G2a (P15), G2a2, G2a2b, G2a2b2, and finally G2a2b2a. In order to determine if one of these alternative SNPs represents a subclade of M201, the alternative SNPs must be tested in G persons who are negative for the known subclades of G. There are only a tiny number of persons in such a category, and only a tiny number of persons have been tested for G equivalent SNPs other than M201. These latter labs also made use of raw data results reported by individuals tested for about 2,000 SNPs at 23andMe to provide new L or S-designated SNP tests. Elizabeth T Wood, Daryn A Stover, Christopher Ehret, L177, later discarded in favour of PF3359 and equivalent SNPs, was first identified at. Kharkov VN, Stepanov VA, Borinskaya SA et al. For the human mtDNA haplogroup, see. Haplogroup G (Y-DNA) In human genetics, Haplogroup G (M201) is a Y-chromosome haplogroup. suggested that: "We estimate that the geographic origin of haplogroup G plausibly locates somewhere nearby eastern Anatolia, Armenia or western Iran. The authors declare no conflict of interest. The general frequency pattern of hg G overall (Figure 2a) shows that the spread of hg G extends over an area from southern Europe to the Near/Middle East and the Caucasus, but then decreases rapidly toward southern and Central Asia. Haplogroup H dominates present-day Western European mitochondrial DNA variability (>40%), yet was less common (~19%) among Early Neolithic farmers (~5450 BC) and virtually absent in Mesolithic . Considering these issues, we acknowledge that the variance of the age estimates may be underestimated. [7], (Subclades here conform to the Y-DNA SNP definitions used by ISOGG In 2012, several categories found only in one man in research studies were removed from the ISOGG tree causing some renaming. Moreover, these general frequencies mostly consist of two notable lineages. No labs have yet assigned them shorthand names. The effective mutation rate at Y chromosome short tandem repeats, with application to human population-divergence time. The suggested relevant pre-historical climatic and archeological periods specified in conjunction with lineage-specific estimated expansion times are specified in the summary portion of Supplementary Table S4.